SubtiBank SubtiBank
divIVA [2019-02-19 20:22:32]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

divIVA [2019-02-19 20:22:32]

curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum, cell division initiation protein (septum placement), part of the Min system (with Z ring placement)
Locus
BSU15420
Isoelectric point
4.85
Molecular weight
19.20 kDa
Protein length
164 aa Sequence Blast
Gene length
495 bp Sequence Blast
Function
septum placement
Product
cell division initiation protein
Essential
no
Synonyms
ylmJ

Genomic Context

      
Loading

Categories containing this gene/protein

Gene

Coordinates
1,612,521 1,613,015

Phenotypes of a mutant

  • Deletion of divIVA leads to filamentation and polar divisions that in turn cause a minicell phenotype. PubMed
  • A divIVA mutant has a moderate [(Pubmed)|26735940] to severe [(Pubmed)|11445541] sporulation defect.
  • The protein

    Catalyzed reaction/ biological activity

  • curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum
  • DivIVA is required for polar localisation of MinC-MinD via MinJ. PubMed
  • It also recruits RacA to the distal pole of the prespore PubMed.
  • DivIVA may anchor SpoIIE briefly to the assembling polar septum before SpoIIE is subsequently released into the forespore membrane and recaptured at the polar septum PubMed
  • required for the compartment-specific activation of SigF PubMed
  • activates PrkC PubMed
  • required for oriC placement during spore development PubMed
  • Protein family

  • gpsB family (according to Swiss-Prot)
  • Paralogous protein(s)

    Domains

  • the first 60 amino acids constitute a conserved lipid binding domain. PubMed
  • the C-terminal domain is less conserved
  • multimerisation involves two coiled-coil motifs, one in the lipid binding domain, and the other one being present in the helical C-terminal domain PubMed PubMed
  • Modification

  • phosphorylated on Arg-102 PubMed
  • The Mycobacterium DivIVA homologue Wag31 is phosphorylated at T73 PubMed
  • DivIVA from Streptococcus pneumoniae is phosphorylated at Threonine 201 by the Ser/Thr protein kinase Sktp1. PubMedPubMed
  • Cofactors

  • not known
  • Effectors of protein activity

  • not known
  • Structure

  • 2WUJ (N-terminal domain) PubMed
  • Localization

  • DivIVA forms a ring underneath the invaginating membrane at the site of cell division and is enriched at both cell poles PubMed.
  • forms rings at the division septum and patches at the cell poles PubMed
  • membrane targeting requires SecA PubMed
  • assembles into a ring-like structure at the polar septum during sporulation PubMed
  • Expression and Regulation

    Operons

    Genes
    Description

    Regulatory mechanism

  • Spo0A: repression, PubMed, in Spo0A regulon
  • Regulation

  • constitutively expressed PubMed
  • view in new tab

    Biological materials

    Mutant

  • 4041 (divIVA::tet), available in Leendert Hamoen's, Jörg Stülke's, and Sven Halbedel 's lab
  • GP1482 (chromosomal divIVA-Strep fusion, aphA3), purification from B. subtilis, for SPINE, available in Jörg Stülke's lab
  • BKE15420 (divIVA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATGCCACCTCCATTTT, downstream forward: _UP4_TAAATTCTCTGATTATCTTG
  • BKK15420 (divIVA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATGCCACCTCCATTTT, downstream forward: _UP4_TAAATTCTCTGATTATCTTG
  • Expression vectors

  • DivIVA-Strep available here
  • pGP1497 (N-terminal Strep-tag fused to C-terminus of divIVA, TEV-site, purification from E. coli, in pGP172), available in Jrg Stlke's lab
  • GFP fusion

  • divIVA-gfp fusions available from the Hamoen Lab
  • Two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Sven Halbedel's and Jörg Stülke's labs
  • FLAG-tag construct

  • GP1776 (spc, based on pGP1331), available in Jörg Stülke's lab
  • Antibody

  • A polyclonal anti-DivIVA antiserum generated in rabbit is described here PubMed.
  • Labs working on this gene/protein

  • Leendert Hamoen, Centre for Bacterial Cell Biology, Newcastle upon Tyne, United Kingdom x
  • Imrich Barak, Slovak Academy of Science, Bratislava, Slovakia homepage
  • Sven Halbedel, Robert Koch Institute homepage
  • References

    Reviews

    Loading

    Original Publications

    Loading